Monday, September 29, 2003

While we're at it, here's my class list::
Fall Quarter 2003
- Music 23 (Elements of Music III, 4 units) -- MTWThF 9:00-9:50
- Music 40 (Music History to 1600, 4 units) -- MWF 10:00-11:30
- Music 174A (Violin, Individual Instruction, 3 units) -- W 5:00-6:00
- ChemE 150 (Biochemical Engineering, 3 units) -- TTh 2:15-3:30
- ChemE 150A (BioProcess Design Laboratory, 1 unit co-req.) -- TBD
- plus partnering Social Dance II

It should be a good quarter. :)

Oh yeah...I almost forgot. I've done this the past two years, so I might as well continue the tradition.

Please meet Testimony A Cappella 2003-2004!
(*=new members, Core in italics)

Sopranos
Ssonia Chee (sr)
Christine Harding* (fr)
Karina Ortega* (soph)
Mia Sakai* (fr)

Altos
Jenny Alyono (soph)
Lisa Kim* (fr)
Victoria Kim* (fr)
Dana Nguyen* (fr)
Tina Wong (sr)

Tenors
Brian Maeng* (grad)
Uchenna Okoye (sr)
Jeff Russell (jr)
David Scudder* (fr)

Basses
Jarreau Bowen* (fr)
Kevin Kuo* (fr)
Rob Majors* (fr)
Tony Wang* (fr)

YAY TMONY!!

Life is WONDERFUL!

New Testimony is AWESOME, post-audition retreat rocked, my music classes are totally right for me, I got placed into violin lessons, my dad is back from Hong Kong and I got to have lunch with him today, and I am SUPER EXCITED about this coming year! So even though I'm exhausted from three straight days of auditions/callbacks, two middle-of-the-night a cappella officers' meetings, rolling out new members, and taking the group on post-audition retreat, I am doing wonderfully. :) I feel really good about where I am and what I'm doing. So much about this year is new. I have new Testimony, I'm in a new major, I'm taking new classes, I'm emotionally unattached in the boy department, and I'm incredibly supported in the friend department. God is doing amazing things. I think I'm finally finding the right place for me at Stanford. I still have no idea what I want to be doing *after* Stanford, but I really feel that switching majors was the decision He was leading me to make. As Jeff said, "it's an excellent thing to be where one is meant to be."

animeita (7:38:11 PM): it's good to see you under less...angst...?
animeita (7:38:40 PM): more...rightness...
animeita (7:38:41 PM): : )
animeita (7:38:59 PM): hm...must be God cuz i can't put words to it
animeita (7:39:01 PM): ; )

Word.

I have many stories to tell about classes, Tmony, and life in general, but there's so much that it's overwhelming. Maybe I'll manage to write about things a little bit at a time later on, but right now I should start finally getting my room organized and catching up on schoolwork. Talk to me in person if you're wondering about anything in particular. Basically, I just wanted to share my joy with you all! GOD IS SO GOOD. I am HAPPY. :-D

Friday, September 26, 2003

After 12 hours of auditioning other people in the past two days, now it's my turn to be on the other side. I have my violin audition in an hour. I am terrified. It has been a long time since I've played violin for anybody, and I definitely haven't had sufficient time to prepare in the midst of all the a cappella madness. I hate being underprepared. Boo to me. :(

Thursday, September 25, 2003

Tina no bloggy. Tina busy. But things are good. God is good. :)

Monday, September 22, 2003

I noticed this morning that I have a huge bug bite on my right arm. I am slightly worried about the fact that it's getting bigger and bigger (now exceeding the circle I can make with my thumb and index finger). And it's exothermic. Bug bites aren't supposed to grow, are they? What is going on?

I am SO STOKED about O-Show tomorrow! We are going to rock! Seriously! We have some cool staging stuff planned, so you'll just have to come see it. HEE HEE.

Dining hall touring went well tonight. The singing conditions were challenging, but I think we did well. We ran into Talisman and the Mendicants at FloMo -- I love the strong sense of a cappella comradery that has been evident during Orientation Week this year. :) We also sang right in front of a whole table of Fleet Street and the former directors of Counterpoint when we were at Stern South Dining, which was slightly nerve-wracking, but I think we held up quite well. Overall we were very well received at all the dining halls. Yay! I'm excited!
(For good measure, the other three a cappella groups not yet mentioned are the Harmonics, Everyday People, and Mixed Company.)

The Music Dept. still won't tell me how I did on my placement test. Boooo. But I signed up for a violin lesson audition time. That will be at 2:10pm on Friday. The audition requires proficiency in scales and arpeggios (from certain specific books; the only one I recognized was Rode, and luckily I have that one), and a movement from either a Bach sonata/partita or any other common violin concerto. I'll probably work up the first movement of Mozart No. 4 again, which hopefully won't take me too long, but I haven't played any etude-type stuff since high school. So in the midst of auditioning other people into Testimony and Opening, I need to prepare myself for an audition, too. Time to practice...

Sunday, September 21, 2003

People in Kimball are so friendly! When you leave your door open, people come in to say hi! A girl across the hall stopped by earlier today, and Dave came to hang out with me for awhile, and some guy named Jonathan just came in to introduce himself. I think living in Kimball will be a very different experience than living in Twain (my other upperclassman dorm experience). Not because Twain wasn't social (it certainly was), but more because I already know so many people here, and I feel like I fit in better. I think it'll be a good year.

I'm happy that amidst all the Testimony craziness, I've also been spending time with non-Tmony friends. Erin came by Kimball on Friday night, which induced much squealing on both our parts. I hadn't seen her in A WHOLE YEAR! (Speaking of close friends who had been gone abroad, it's also really wonderful to have Bryan back! Yay Bryan!) Erin also came by the Tmony table on Saturday morning, so we got to chat a little bit. That afternoon I had lunch with Scott, and we walked around campus for a little while and stopped by Mars to visit to Kimberly Kwon (they know each other through orchestra) -- another interesting collision of my two worlds (Kim and I went to middle school together for a year (she's two years younger)). It turns out that Kim's sister (Michelle) is also at Stanford this year as a freshman! I don't think I've seen Michelle since they left the Castro Valley school system, so I'm looking forward to some kind of a Castro Valley reunion (we really should get our quarterly dinners going again). It was fun to hang out with Dave tonight too. Yay for friends from so many different places. :)

The Tmony hangout last night was a lot of fun. After our afternoon rehearsal, we ate dinner at Stern (hey, it's free food, already paid for by the Orientation people) and went out to Coldstone's for ice cream. I had a yummy strawberry cheesecake concoction - mmm. :) Then we watched the Testimony slideshow again (created at the end of last year), and played one huge game of Taboo for an hour and a half. Taboo is such a great game! It produces so many moments of sheer hilarity. Here are some highlights::
- "From A to Z." - "Centrum!"
- "You take these in class..." - "Naps!" (That was Uchenna)
- "A city in Nalani!" (word = Waikiki)
- "Mothers make these on little women." - "Braids." (Chi-En guessed that with absolute certainty, after giving it exactly one second of thought)
There were plenty more, but I'm having trouble remembering them right now. (Tmony, feel free to leave other quotes in my comments box. Hee hee.)

We decided at the last minute that we want to sing at various dining halls during dinner tomorrow night. (Originally I wasn't going to make us do it since we're already so busy, but the group brought it up themselves. Aren't they awesome?) So we whipped up 3 old songs in practically no time, at the end of tonight's rehearsal. Most people didn't even get out their music. Testimony is cool. :D

Welp, it's time to go flyer all of Manzanita with our new recruitment posters (since it's "Monday" as of midnight). Come audition for Testimony! ;)

Friday, September 19, 2003

Whew. I'm beginning to remember why I didn't blog at all during Orientation Week last year. Not only am I running around all day, but I also generally have no motivation to blog even when I have the time. There's a sliver of it hovering in my mind right now, though, so I'll write while I still have it.

Yesterday was more or less what I described in my plans from the night before. Rehearsal went well, Convocation was HOT, and cleaning up the chairs was way more efficient and organized this year. Definitely the most "exciting" moment of Convocation was when someone pointed out that ALL THE CHAIRS WERE ZIP-TIED TOGETHER IN ROWS. This was not in the least amusing to the a cappella people. It all ended up fine, since the OV's (Orientation Volunteers) went down each row and cut every single ziptie with a box cutter, but it definitely caused a few moments of semi-panic among those of us who had the task of moving all the chairs afterward. The chair-moving actually took significantly less time than last year, so that was nice. And thus ended our manual labor commitments to New Student Orientation.

I am still very far from being unpacked. That was the plan for last night, but I completely zonked out on my bed after dinner. Then there was some interesting a cappella drama going on (one group started flyering White Plaza earlier than the agreed time (a cappella recruitment is very standardized at Stanford)), but luckily it didn't blow up into a big deal and everyone handled it very maturely. Yay for maturity and drama-avoidance.

Today involved (surprise) more running around. We started tabling White Plaza (i.e. setting up an informational table for recruiting new members), and we already have a few audition signups. I expect that audition slots will get filled much more quickly after we perform in the Orientation Show on Tuesday, so I'm not worried. Our new posters look absolutely great! (See our website for one of the designs.) We also got our new banner freshly printed from Kinko's, and it's proudly displayed next to the bird cage with all the other a cappella banners. It's the first time we've had a banner like that to put up! Exciting!

I am having an inordinate amount of trouble getting space reserved for Testimony and Opening. Elliott Program Center is being poopy and won't let Opening use Elliott *at all* this year (specifically Opening and the Tango Club, not other dance groups). Braun is being poopy and gave us weird locations for Wed. and Fri. of auditions, and nothing at all on Thurs. (so in an attempt for irony, I'm trying to see if we can get Elliott for that 2nd day of Tmony auditions). Roble Dance Studio is iffy on giving us a second rehearsal day (we already have Saturday, but we also need a weekday -- and, of all things, we're battling Richard for the Wednesday slot! He wants it for his Waltz class...AGH), and Braun won't schedule anything for a cappella groups more than one week in advance (so we can't rely 100% on having a rehearsal location). It's difficult to get permission for dorm lounges right now since no one has a reservation system implemented yet, but that's what we're shooting for in the next few days until O-Show.

Tonight's rehearsal went very well. I like Testimony's recovery curve. It's relatively easy to get things sounding good again. I'm looking forward to dazzling the freshmen. ;)

Wednesday, September 17, 2003

I'm back online! Ugh - network registration was a huge pain this year. They had a whole batch of software updates required before we were allowed to update Rescomp, and it took me a million tries before I could get things to work. But now it's finally working.

I really like our room in Kimball! It's a lot bigger than I expected, and a different layout than I expected, so I was very pleasantly surprised. It feels very roomy, and I get a nice breeze through the window next to my desk. Come visit me!

Today was a very long day. Moving in took longer than expected, but it all got done in time, so that's what counts. Many thanks to Tim for coming to help me move. We just barely finished unloading everything in time for me to switch cars back with him (I get the Volvo this year - yay! But I had the mini-van so I could move all my stuff in one trip). Bryan and I made a record-fast trip to Kinko's to approve the poster proofs (though the banner proof didn't turn out right so they're redoing another one). The NSO meeting was shorter than I expected, and setting up Parents' Dinner went efficiently, so the rest of the evening was ahead of schedule. It was wonderful to hang out with everyone in Tmony again. :)

The officers' meeting was pretty quick and painless, too. It was kind of weird being the one in charge. A couple of groups sent their last year's director as a temporary representative (rehearsals conflicted with the meeting), but other than that I really was the only one who'd been through Orientation as an a cappella officer before. I was pleased that the meeting went smoothly and that I for the most part knew what I was doing.

At the current moment I am eyeing my boxes warily. I'm exhausted, but there's a lot in the way between me and my bed. So I'll have to get organized a little before I can crash. Tomorrow is going to be another long day:: rehearsal space hunting, another Kinko's trip, Tmony rehearsal, singing at Convocation, and more manual labor (breaking down several thousand chairs under the hot sun). But hopefully tomorrow night I'll get a breather. :)

Happy Birthday, Emmy!!

The madness snuck up on me. I'm already in the middle of it. MEH. All sorts of things (like Testimony poster design, and general a cappella organization) have popped up at the last minute. Our "Core hangout" last night (which feels too soon ago to be called "last night") became effectively a "half-meeting, half-eating time of poster approval and getting intimate with the Kinko's late-night staff." But at least there was a lot of hilarity mixed in there (Core is going to be super fun this year. We laugh. A lot. I'm excited!). So basically, I'm already heavily in the Lack Of Sleep Zone. Oh well - it's a familiar feeling. In a few hours will begin the Time During Which Tina Runs Around Like A Headless Chicken. Heh - I'm really not kidding when I call this the a cappella marathon. Maybe I'll try to document it a little better this year (I blogged absolutely nothing during this time last year), so I can remember the madness a little better years down the road. ;) Riiight...we'll see whether or not that happens. (Here's an example of what that would look like. Today includes:: loading all my belongings into the car, final cleaning of the apartment, dropping off Jeff on campus, buying a parking permit, picking up my key at 10:00am, moving all my belongings into Kimball, going to Kinko's to approve several proofs of our audition posters, eating lunch, finding a new bike at the Bike Shop, attending an all-a-cappella group meeting with the Orientation Coordinator at 3:00pm, setting up tables/chairs for Parents' Dinner immediately afterward, then dinner and prayer with old Testimony, picking up the portion of Testimony Junkpile currently stored at Jeff Lee's apartment, an a cappella officers' meeting at 9:00pm (which I completely forgot to schedule until 12 hours ago because it slipped my mind that I am the only returning officer out of all 8 groups), and - perhaps - unpacking. You know. That sort of thing.) Anyway, cell phone will be the best way to reach me in the coming two weeks. Wish me luck! And please pray for my health and endurance. :)

Tuesday, September 16, 2003

Current Music:: Mandy Moore - "Only Hope"
I have discouragement of a different sort on my hands now. I just found out today that 4 of the people whom I thought would be returning to Testimony may actually not be returning. That means it's entirely possible that the returning members of next year's group could consist solely of Core -- which is three people, including me.

I know God must have something in mind, but it's hard to watch your group's membership drop like flies. I think I have an idea how Ben was feeling last month when the outlook of FCS was looking equally dire -- at one point, they were only going to have four returning members, one of whom was the vocal percussionist (not a singer) and two of whom would be graduating after fall semester. But God brought them the people they needed, and FCS is doing wonderfully. So that's precisely why Ben is in such a good position to encourage me right now. He called tonight to pray for me over the phone, which was a huge blessing (thank you, Ben. You're truly gifted in prayer). He pointed out that God often humbles his leaders in order that the final outcome may glorify Himself even more. I think that's very true, and it's interesting to see that pattern at work across different groups (particularly this year's campus fellowships) and even across different campuses. Thank you also to everyone who has been quick to support me in prayer and in conversation, reminding me of God's sovereignty and faithfulness. As scary as it is that I could be starting off the new group with only Core returning (and a small Core at that), I know that God will provide for us according to his plan.

Don't get me wrong -- I don't see this as if the people who are leaving Testimony are somehow inflicting hurt upon the group. I trust each one of them to discern where God is calling them to spend their time this year, and if that doesn't include Testimony, then it just doesn't include Testimony. God has plans to prosper us and not to harm us, both individually and corporately, and He doesn't subvert Himself -- that would be against His nature. So I still think that God has exciting things in store for Testimony this year, and that's not changing just because I feel blinded by unknowns. It's like I'm learning this lesson all over again. I guess you can never learn it too many times.

Monday, September 15, 2003

Current Music:: Sara Groves - "Conversations"
Well, I was discouraged from staying overnight at home, so I made the late drive back to Menlo Park last night. My mom is sick with laryngitis, and my dad didn't want me to catch it from her. Normally I'm not that squirmish about other people being sick, but given the fact that the a cappella madness is about to begin, it would be very bad if 1) I got sick at all, and 2) the illness made me voiceless. (Like poor Chi-En, who has a throat infection. We're hoping she gets her voice back soon...) Yes indeed, that would be really very bad. So I don't intend to get sick.

My brother cooked a delicious spaghetti meal for our family last night. The silly boy makes a huge mess of the kitchen when he cooks, but he's great at the cooking, at least. Thanks, Tim!

Earlier in the evening, my dad and I went to his office to retrieve various Tmony things that we'll need for recruitment and auditions. I dislike moving residences anyway, but it sucks even more being the Keeper Of The Ever-Growing Testimony Junkpile. We have so much random *stuff* -- skit props, old paint bottles, candles (?!), banners, folding table and chairs, recording equipment, huge music archive binders, paperwork/records, and old albums (both CD's and cassettes!), in addition to the many boxes of Echoes CD's. Most of this Junkpile lives either in my garage at home or in my dad's warehouse, but I have at least half a dozen boxes with me that need to be easily accessible. I wish there was some storage space available on campus for student groups, so that group belongings wouldn't have to live under the bed of the director. In any case, once people get back onto campus hopefully we can spread the burden among the rest of Core and returning members.

Sunday, September 14, 2003

JuKa828: boo!
TPiglette: moo!
JuKa828: hahahahahaha
JuKa828: i like that
TPiglette: actually, maybe it should be "boo, poo, moo, foo"
TPiglette: :-P
JuKa828: hahahahahaha
JuKa828: HAHAHAHAHA
JuKa828: i cant believe i got that

Current Music:: Jake - "(Make Me a) Believer"
I discovered today that Charlotte speaks Spanish! She wanted to know my middle name, and upon finding out that it's my Chinese name ("that's so pretty!" -- awww), she exclaimed, "Guess what my name is in Spanish?? Carlotita! That means 'Little Charlotte'!" Apparently, her school teaches things in Spanish (or that's what it seemed like from what she was saying), and they have a separate English teacher. So Charlotte and I spent some time writing her family's names on the whiteboard in both English and Spanish (she included me, too -- awww again!). Hee hee, I'm going to start speaking to Charlotte in Spanish now. How fun!

During second service, I was pleasantly surprised to find Keith giving today's message. Keith Zafren is the head pastor (and founder of the church), but due to some personal difficulties within the past year, he hasn't been teaching as regularly as he used to. So today was really awesome -- it was so refreshing to hear him speak again. It was a clear reminder of why I chose The River in the first place: definitely because of the teaching. Today brought back a lot of memories of when Keith spoke nearly every week, back when The River still met at the Sunnyvale Community Center -- back when I was still first getting to know God.

The message itself was very accessible, thought-provoking, and encouraging. The current teaching series, which began today, is titled "Seeking and Finding God," and today's message centered around the verse, Mark 9:24, "I do believe, help my unbelief." I wouldn't do it justice by trying to summarize here, but if any of you are interested you can always talk to me about it, or check The Reservoir (The River's online library of message transcripts) to see what any of the current or past series have been about (though there's usually a bit of delay before things get posted). While I'm at it, here are some other resource links that I've found interesting and helpful.

I'm going home again today, to see my dad before he leaves for Hong Kong for a couple weeks. Other than that, I'm mostly just busy in the Realm Of Much Cleaning And Packing. (Moving is such a pain.)

Happy Birthday, Ben Poon!

Friday, September 12, 2003

Current Music:: Rockapella - "People Change"
I just got my hair cut. But it was just a trim - only a couple inches. So it's still quite long, and not the sort of difference that guys would ever notice (even only some girls would). Dave, however, claims that he'll "totally notice!"

This is what Graham had to say...(on comparing the male species to...another species).

WhistleDance (3:26:28 PM): well sure he will.... now that you've told him
WhistleDance (3:26:41 PM): (thanks for the heads-up on this, btw)
TPiglette (3:27:06 PM): you wouldn't have been accountable for noticing ;-)
WhistleDance (3:27:17 PM): oh?
TPiglette (3:27:29 PM): see my above comment about guys ;-)
WhistleDance (3:28:12 PM): yeah, sort of like you wouldn't care if your pet dog doesn't notice
WhistleDance (3:28:14 PM): it's just beyond us
[...]
TPiglette (3:32:41 PM): anyway, I doubt I'll change shampoos. it would throw Justin off. ;-)
WhistleDance (3:32:56 PM): not to mention me
WhistleDance (3:33:03 PM): Poor guys... so easily confused
WhistleDance (3:33:13 PM): we *are* like dogs
WhistleDance (3:33:18 PM): not noticing haircuts
WhistleDance (3:33:23 PM): but very attached to smells

Tee hee. Quotes are fun.

In other (slightly old) news, Kari and I have finalized our housing situation. Once the Housing Services transferred us both into Kimball, the Kimball House Staff automatically put us into a one-room double -- Kimball 315. So we didn't even have to make any roommate-switch requests. I'm glad that's all finally settled.

In newer news, I finally have my student registration back! (There was a whole logistical nightmare due to taking an Incomplete last Winter and then going on Leave of Absence immediately afterward.) I just submitted the request yesterday, and it's already fixed! Yay! Big Phew.

I also turned in my Music placement test yesterday, but the professor who grades them is out of town for a week. So I have a little while to wait before finding out. I think it went relatively well, though some parts were certainly challenging. Since I never formally learned counterpoint/voice-leading (I taught them to myself by reading theory books in preparation for this placement test), I wasn't as confident as I would have liked, but I think I did alright. It felt like a fairly good representation of how much music theory I already know. I'm pretty sure I did well enough to pass out of Music 21, but I'm not sure about 22, and that's what I really need. I can't proceed with switching Majors until I hear back about my placement. *crossed fingers*

So it seems that things are slowly falling into place. Hopefully that trend will continue...

Wednesday, September 10, 2003

Messages are fun, especially ones like these...

Vortexyz (9:45:42 PM): holy moly, you think you want to do a music major?
[Auto response from TPiglette (9:45:43 PM): pulling lots of music theory out of my brain...]
Vortexyz (9:45:49 PM): YAY!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Vortexyz (9:45:51 PM): <breath>
Vortexyz (9:45:56 PM): YAY!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

---
*Edit: Wow, Hector was really hyper...

Vortexyz (10:04:43 PM): BYYYYYYYYYYYYYYYYYYYYYYE
Vortexyz (10:04:56 PM): good luck with the music test

I just picked up the Music Dept. take-home placement test, and it's due tomorrow at 2:00pm. Wish me luck! Please pray for me. :)

Tuesday, September 09, 2003

Comments are back! Leave me comments! :-D

Happy Birthday, Kris!

JuKa828: a;lsfdkjdsavnm/vawe[ua[ewfja';sldfkj/,vna';lfja[werf
TPiglette: snails love you too
JuKa828: what??
TPiglette: I dunno it was the first thing that popped into my head
JuKa828: HAHAHAHAHAHA
TPiglette: wow I got an uncorrupted string of HA's
JuKa828: :-P
JuKa828: rare, i know
JuKa828: ACGATCGACTACGATCGACTAGCAGCTACGACATCAGCGACTACGAGACTAGTCAGCGAGAGGACGACTATCTACGACGCAGACTAG
TPiglette: ewwwwww
JuKa828: what? just random letters ;-)
TPiglette: actually for some reason that LOOKS like a fake sequence
JuKa828: HAHAHAHA
TPiglette: no I'm serious
JuKa828: well i just typed it in at random
JuKa828: its too evenly spaced
TPiglette: it's too regular
JuKa828: real sequences have patterns
JuKa828: and GGGGGGGG
TPiglette: yeah
JuKa828: yeah
JuKa828: this is sad
TPiglette: I was about to say that

Monday, September 08, 2003

My main set of PJ's is by far the most comfortable clothing I own. I have other pairs of flannel pants, and they're all nice, but nothing compares to my blue-green plaid pajama pants. They are SO SOFT! And so is my favorite sleeping shirt EVER. It's probably the oldest t-shirt I own, which is one obvious explanation for its softness, but you know how there are different t-shirt materials? Well, this is that REALLY soft kind. I got it in middle school, and it's still big on me. How silly. But I love it!

Does anyone else still have this t-shirt? The one that says: "IT'S NOT JUST A LETTER! <insert image of dorky condor (the Canyon Middle School mascot) leaning against a big red-colored block letter "A"> -- Good Grades Are Hard Work -- Castro Valley Renaissance -- 1996"? Wow - that would have been 8th grade for me. Anyway, I've always thought that: 1) the condor looks angry, 2) the "grades" theme was muddled by the fact that the condor has a "C" on his chest (for "Canyon"), and 3) didn't anyone catch the connection to The Scarlet Letter before they printed this shirt???

Omni polkas = booo. I can't do them. :( Otherwise, the choreography is going well. I'd forgotten how much of a pain it is to plan details for auditioning people into a group, though. Running things with Testimony is so much easier the second time around. With Opening, I still feel like a newbie in a lot of ways. Luckily, I have great people working with me, so it's all good.

Highlights from the Core meeting (behold how we eliminate songs from the potential repertoire)::

Codigo2000 (11:57:16 PM): i don't think that one really fits
TPiglette (11:57:22 PM): I'm sorta ready to drop that one
Codigo2000 (11:57:27 PM): me too
Codigo2000 (11:57:32 PM): jenny?
jenono8 (11:57:51 PM): cross it out
Codigo2000 (11:57:56 PM): it's gone
TPiglette (11:58:05 PM): *poof*
jenono8 (11:58:15 PM): *Squish

Codigo2000 (12:18:11 AM): ...my gut instinct is no
TPiglette (12:18:53 AM): my gut instinct is no, too
jenono8 (12:19:08 AM): (jenny has no gut)

Sunday, September 07, 2003

Current Music:: Tim Hughes - "Consuming Fire"
The worship set at church this morning was really good. Usually I find that there's at least a couple songs where it's hard to connect with the music style or the lyrics (in which case it becomes a good exercise in willful worship), but today it seemed like every song touched my heart deeply. I guess it helped that I was familiar with nearly all of them, and that there was a higher proportion of slow, quiet songs than usual, but still. It was very powerful. I haven't had worship like that in awhile.

My kids in class were hilarious, as usual. Today's excitement was the beautiful blue Siamese Fighting Fish that Jim had brought in as a prize for whomever had the most points at the end of class. The grand winner was Emma Heckenberg, much to the dismay of the other close contenders, Matthew and Charlotte (but not to the dismay of Charlotte's mom). (Graham, if you're wondering, Charlotte says she has lost the staple-decorated butterfly. She seemed concerned at the thought for a few seconds, but then promptly forgot about it. Kids.) For some reason, Charlotte, Kimber, and Melissa were particularly clingy today. Of course I didn't mind, since they're all so adorable. But because they wanted my attention so much, I ended up reading the same book to a different pair of them three times. I practically know that story by heart now.

I was originally going to go home this afternoon to see my mom who's just returned from New York (she wanted to come back earlier, but my 3rd Aunt (that's what I call her in Chinese: "Sam Yee") is still staying over there with my 6th Aunt ("Lok Yee")). (My mom would be 4th Aunt. There are nine siblings in total, six of whom are sisters.) But we've postponed the visit until Tuesday, when I can stay in Castro Valley longer than just a few hours. There's a Core meeting scheduled for tonight, and I need to take care of things on campus tomorrow, and we're working on choreography tomorrow night, so Tuesday is much better. That change in plans allowed me to catch up on more sleep this afternoon. I hadn't realized that the past week sapped so much out of me, but I've been exceedingly tired. Not having to go to work tomorrow morning is a very pleasant thought. :)

Saturday, September 06, 2003

Current Music:: Nine Days - "If I Am"
The acoustic version of this song is awesome. The only thing missing is the cool upper harmony in the choruses. Otherwise, it's a better version, in my opinion. This song reminds me a lot of freshman year -- being roommates with Emily, listening to music with Eric in our room, and the general feeling of living in Rinc. Good memories.

Today has been a nice, lazy day. Lots of relaxing, getting organized for the coming week, and napping. I'm glad I'm done with work. I was definitely feeling ready to be done. I'm not sure if I'm ready to go back to school, but that's no different than the past two years at around this time. I really hope I'll be able to make this school year different. I'm tired of feeling like a failure.

On a lighter note, I found this silly personality test on Gavan's xanga and decided to take it (ah, the mindless things you can do with oodles of free time). I usually think all personality tests are silly, especially ones about dating and relationships, but they're generally amusing and it's fun to see what they say. This particular one seemed more complicated and structured differently than most. I'd actually be curious sometime to see how these things are created -- how many different possible outcomes are there, what's weighted more heavily than others, and how much of the results are just clever rephrasing of the questions? Anyway, for your amusement, here's an excerpt from my results page (they actually put a bunch of pie charts and stuff in it, which obviously I am not going to take the time to post here, but I found it amusing as their way of trying to seem "scientific" and "credible" -- so silly):

[ Who You Are ]

::You're a hidden flower::
You're a very strong and loyal person. You're responsible and work hard in everything you do. In fact, you're the one that co-workers and friends run to when they have problems. You have a vision for the future and always are searching to find love and a sense of "balance" in your life. You have a shy and reserved exterior, which leads some to think you're distant, or a snob. But in fact, you're simply a very mellow, modest, and gentle woman. You feel deeply about your loved ones and the important issues in your life. Someone who invests in getting to know you one-on-one will discover your deeper sensual and romantic nature.

::What's dating all about to you?::
Falling in love is a spiritual experience for you. A truly loving relationship helps bring meaning to your life. You try hard to make your date feel comfortable and have a good time. You're good at anticipating what other people need and giving it to them. But inside, you're usually on an emotional roller coaster. You don't want to reject nice men, but also take it very personally if you're the one rejected. You're constantly trying to find the "rules" for successful dating but often find they don't work.

You face two major challenges in finding the love of your life. First, because you're shy, you feel like you have to be someone else or "wear a mask" to go out and meet new people. You're left feeling like a distant observer, and men find it hard to truly understand you. Second, although your compassion for men is a very attractive quality, your focus on him can get in the way of getting what you want and need.

::Quirks men notice::
Like all women, you have your strengths as well as your quirks and shortcomings. Ultimately, you want to find someone who will love and accept you "warts and all." Because you're a private person, it's especially important that you find a partner who understands.
- On most days, you need to get away from other people (including your loved ones) and have quiet time alone to rest and recharge your emotional and social batteries.
- The organization and time-management skills that serve you so well in your career can spill over into your personal life and at times make you seem controlling and impatient.
- You can worry too much about your relationship and need reassurance that things are okay.

[ Who You're Looking For ]

::He'll come to your rescue::
You're looking for a man who can be a pillar of strength and stability in your life. You want a man you can count on to do what he says and say what he means. You'll be impressed by how responsible, strong-willed and hardworking he is. If you're ever in a crisis, he's definitely the man you'd want to come to your rescue. He's very intuitive and has a lot of "common sense." He has a shy and reserved exterior, but one-on-one you'll find he talks openly about himself and what's important to him. He'll dress and act conservatively, but behind his serious exterior is a very loyal and faithful potential partner.

Overall, it's important for you to be with someone who is almost always cheerful and has an optimistic outlook on life. The ideal person you're seeking shares a number of positive qualities with you, including:
- You both share a cheerful and optimistic outlook on life.
- He's organized so he plans ahead for dates and is always on time.
- He's exhausted by lots of social activities and needs "down time" alone or with you, reading books or watching videos, to recharge his batteries.

::Opposites sometimes attract::
You want to share your life with someone who has the same values, goals, and style you have. Research has shown that couples who have more in common tend to stay together longer. Still, sometimes differences can help create a "spark" and excitement about each other. Part of you wants to be more like him, or at least have his unique style in your life. He could be good for you in many ways:
- He can act as the "voice of reason" and objectivity when you're too swayed by emotions.
- His sensible and pragmatic view on things can keep you "grounded" and prevent you from getting too caught up in somewhat unrealistic plans.

::Quirks you can tolerate::
The truth is that everyone is potentially "high maintenance." We all have our quirks and shortcomings. The key to long-term harmony is finding a man who can tolerate (or maybe even enjoy) your "quirks," or the little personal oddities that make you unique. You seem okay with several common quirks that might come along with your "ideal" man:
- When he says something that comes across a little harsh or insensitive, you typically can overlook it because you know he didn't mean to hurt your feelings.
- You can understand his career drive and crises at work, even though he sometimes drags these hassles home.
- You can honor his need to be quiet and have "alone time."

::Downside of your "ideal"::
In addition to his quirks, your "ideal" personality type may have other qualities that are more frustrating or challenging to deal with. Under stress, his quirks can become serious "flaws." But remember, these quirks are the "flip side of the coin," or the extreme end of qualities you otherwise find appealing. So, be prepared if:
- Because he's such a rational thinker, he may seem cold and heartless at times, especially if the two of you are facing a decision that involves complex emotions or other people.
- Because he stays so focused on day-to-day life, he may question some of your plans and ideas for the future because they seem impractical and unrealistic given where you are right now.

::Deal breakers::
You seem ready to adapt to the good and frustrating qualities of the men you're looking for, but there are types of men you clearly do NOT like. Men's habits and attitudes you'd have a hard time putting up with include:
- Men who expect you to be sexually active and adventurous early in a relationship.
- Men who wait until the last minute to make plans (for weekend fun, for example) and even seem to resist your attempts to plan activities ahead.
- Men who are "touchy-feely" (need to discuss their emotions frequently, may cry at movies, etc.) and make major decisions, like whether to move, or which job to take, based on feelings rather than objective facts.

-----
And here's the little informational paragraph that was at the bottom::
[ Where did the test come from? ]
The test you just took is the most scientifically grounded and customized personality assessment on the Internet. It's a "smart" test because it can tailor specific questions to you based on your earlier choices so no one gets exactly the same questions. The content of the tests and the game-like way the choices were presented are the result of over 15 years of research by the scientists at weAttract.com, Inc.
-----

Riiight...well, that was amusing. Haha, and you guys can't even leave comments. That could be a good thing. ;)

Current Music:: The Corrs - "Somebody For Someone"
I FINALLY found this song!!! It's one of my favorite two-steps that Richard plays during social dance classes, but he only knew the title and not the artist. It turns out he was even wrong about the title being "Look At Me." So although I've wanted this song for really long time, having erroneous information about the title, no clue on the artist, and insufficient memory of the lyrics made for many unsuccessful Google searches. But last night at FNW, Richard played the song again, and Graham found out for me from John Bauer that it's by The Corrs! So even though I still had the title wrong, adding "The Corrs" into the query was enough to find a full set of the lyrics. Now I know what the song is *and* I have it on my computer! I'm so happy!!

Friday Night Waltz last night was a particularly satisfying night of dancing, for some reason. I actually wasn't at all sure how much I would enjoy it, since I was so tired from a long last week at work (I dozed off while Kari was cooking dinner (thanks, Kari!) and woke up really disoriented, kind of cold, and groggy-headed -- not fun). But once I got to the dance, I had a lot of fun. Good friends, good music, good dancing - yay! It was a nice way to celebrate being done with work.

Chi-En left this morning. :( But I'll see her in two weeks, so that's okay. We were both really busy this week, but the little time we did spend together was really nice. It's hard to explain the connection I have with Chi-En, but it's pretty cool. :) Anyway, before she left, she said some things which I will henceforth quote here::

Tina: "It was in a bag of stuff I extricated from my Mirrielees kitchen things."
*Chi-En cracks up*
Tina: "What??"
Chi-En: "'Extricated' is a word I would use. But when you say it, it sounds dumb."
Tina: "HEY!"
Chi-En: "So now I know how stupid I sound!"

Chi-En: "What would your dream job be if all practical whatevers were whatever?"
*Tina cracks up*
*Chi-En cracks up* "Oh no you don't! You have to pay me royalties!!"

I am sad that my comments service has been down for so long. I think I'm missing out on a lot of comments. :( If you guys want to humor me, you could leave me retroactive comments once the server is back up! But that still won't be for another couple days. Booo. I know they're working on it as quickly as they can, though, and YACCS has been such a great, reliable service in the past two years that I'm not really feeling that impatient. Never fear, comments will soon be here! (Sorry, that was bad.)

Friday, September 05, 2003

Things I don't want to forget about Applied Biosystems::
- the view driving in to work, along the Bay, seeing the bridge high-rise straight ahead and the water crashing onto rocks just 20 ft. on the other side of the road.
- the view driving out from work, esp. on Fridays, when there are dozens of windsurfers right in front of me, their colors dancing in the clear blue sky.
- the flower bed next to the driveway next to the 200 building -- planted, in different colors, to look like a double-helix strand of DNA.
- my supervisor's license plate: "RNA2DNA" (hahahaha)

<Digression> From Justin's email yesterday: "you know how my computer is named 'neutrophil?' well, apparently all the computers in our group are named like that. today two people came down carrying away 'monocyte.' HAHAHAHAHAHAHAHA." </Digression>

They took me out to lunch today, for dim sum at a restaurant in the Foster City Marketplace. Yum. I'm going to miss the people I work with here. This has been a good place.

Goodbye, Applied Biosystems, for the third time. Who knows if there will be another?

It's been awhile (or so it feels) since I asked for prayer for my family. But I think I'm there again.

"[The Lord] gives strength to the weary
and increases the power of the weak.
Even youths grow tired and weary,
and young men stumble and fall;
but those who hope in the Lord
will renew their strength." - Isaiah 40:29-31

Thursday, September 04, 2003

Fefoofix: hey, did you know that you know two chem e people who are also farm animals?
Fefoofix: justin cow and felix lamb!
TPiglette: HAHAHAHA
TPiglette: that means I need to start calling you "baa"
Fefoofix: hehe
Fefoofix: uhm...
TPiglette: HAHAHA
Fefoofix: moo and baa?
TPiglette: YEAH!
Fefoofix: okay, i shouldn't have pointed that out.
TPiglette: hahahahahahaha

Hahaha. The meeting turned out to be SUPER small. Apparently most people are gone in Berkeley today for one of the company's road show stops. So I ended up only presenting to Mr. Marketing Guy, a couple people in our subgroup, and my supervisor. It was so informal that they insisted I sit down while giving my talk. And Matt (aforementioned "Mr. Marketing Guy") was really nice to me today. He liked my data! Everyone liked my data! Yay!

I just spent about half an hour talking with my supervisor, reviewing over the summer and whatnot. It's one of the longest non-work conversations I've ever had with him, because he's usually a really quiet person, and so am I, so when you put us together you get... quiet people. He told me that I did a really excellent job this summer and that if I wanted to, I could definitely get a full-time job at Applied Biosystems after I graduate. That surprised me. Even after I told him about my plans to switch majors and thus only have a Minor in ChemE, he said that he's pretty sure I'd still get hired with no problem, since so many people here know me and know what I'm capable of. That surprised me even more. But it was good to hear, and definitely good to know.

I have an "exit interview" with the Intern Coordinators at 4:00. I'm interested to see what this "exit interview" is because they've never done them in previous summers. Oh well. If they ask me about my project, I could give them a whole spiel. ;)

Yay! I feel so much better now!

Gah. The meeting has been delayed 10-ish minutes because the marketing guy (who went to Cal and gives me no end of grief for being a Stanford student) needs to be late. I'm already a nervous wreck. I *hate* speaking. And all these people are older and wiser and smarter than me. Eep... :(

Well, I might as well resign myself to it. My computer will always be messed up when I arrive at work in the morning. Luckily, that only applies to one more day. This morning the network connection had somehow gone berserk again, and I couldn't find my supervisor. So I muddled around with tab-delineated text documents (Excel would be too risky), until I had the brilliant idea to go into the Network Connection Panel and click "Disable" (I certainly had nothing to lose) and "Enable" in the hopes of tricking the computer into *thinking* it had been rebooted. And it worked! So now that I can backup my work onto the server periodically, I will dare to use more complicated software.

I have to give a presentation at 2:00. :(

Wednesday, September 03, 2003

Current Music:: Michelle Branch - "One of These Days"
My recent posts have been pretty blah-sounding. Sorry about that. That's not a really accurate picture of how things are going. Though I am tired (especially at the moment), overall everything is pretty good. So here are some recent highlights:

We finished the waltz on Monday! Well, everything except for the intro. So that means both choreographies are pretty much done, and now we'll be learning to dance it ourselves and figuring out how to teach it. Go team!

I finally watched The Red Violin over the weekend. Twice, in fact. (First with Justin and Graham on Saturday, and then again with Chi-En, Jenny, Annie, and Gavan on Monday.) I had heard of the movie back in high school, but I never got around to watching it until now (which also applies to a whole lot of other movies). What an amazing film! I normally don't do "favorites" (because there are so many factors that go into making something "good", and also so many genres, that I can never compare apples and oranges; the same goes for music), but this could quite possibly be my favorite film for its story. The filming itself was exquisite too. They definitely did their research on all the countries (and languages and cultures) through which the story weaves, and I'm amazed at how realistic the violinists were. One of my biggest pet peeves about musicians in movies is when they're very clearly not playing their instrument to match the soundtrack -- but most of the actors were nearly seamless (excepting only a few of the gypsies and orphans). Makes sense, I guess, since it is a movie about a violin, after all. Anyway, the movie definitely exceeded my expectations. It doesn't even feel quite right to call it a "movie"; the word "film" seems more appropriate for such a great work of art.

One exciting moment for me was recognizing the scene in the Sheldonian Theatre. As the camera panned around during that concert scene, I immediately thought, "Whoa...that place looks REALLY FAMILIAR." But then I thought, "Nah..." and then, "But it really looks like it! I think I've been there!" Seeing the red-and-gold chair-looking thing in the audience area just about clinched it for me -- and sure enough, the end credits revealed that the English-language portion of the movie did indeed take place in Oxford. It was really cool to realize that I had actually performed with an orchestra in that very theatre on the movie screen!

Dancing at Swing Central last night was fun. Chi-En and I were late because she had to rehearse something for her brother's wedding, but I'm glad we made it. There was a good Stanford crowd again, though not as many as the last time I went. I'm still not really sure what to think of the place, since each of the three times I've been there has felt fairly different. In general it's a much more relaxed atmosphere than the Doghouse and their music has a wider variety of tempos. Still, though, I'm looking forward to a real Jammix in October.

Discovery:: Armed with both a hairtie and a claw clip, I can now finagle my hair into a bun! And, for the most part, it actually stayed up last night! Amazing! My hair is a huge pain when I go dancing because it generally dislikes being anything other than down. But if I can pull off buns on a regular basis, this is going to revolutionize my dancing! Oh, the excitement!

I am SO FRUSTRATED with my work computer. This morning, the IP connection wasn't working, AGAIN. And within two minutes of trying to do some work, the computer froze (Microsoft Excel was evidently just too much to handle) and I had no choice but to reboot. Well, there was good reason I was told yesterday not to reboot, because when the computer started up again, I couldn't log in with my username. I think the IT guy changed the server path or something, but whatever he did, my account can't access my own computer anymore. I left IT another message, but decided it would be in my best interests to find my supervisor, in the hopes that he might have the Administrator password. Well, he didn't, but for some reason, his personal username could log in. I still haven't heard from IT, but at least I'm able to access my files now.

I just need to get this dumb PowerPoint presentation done (about which I was told only yesterday, to be given tomorrow, and I hate presentations), and wrap up all my data analysis so someone else can pick up this project after I'm gone. Is that so much to ask??

Power outages make life interesting. Chi-En and I arrived back at the apartment (returning from Swing Central) to find everything completely dark. It was really creepy walking by the pitch-black carpark area, so even though I had my handy flashlight I was glad not to be alone. We've been having Fun With Big Fat Candles for the past hour (including some nerdy discussion about the circulation of liquid wax near the candle wick). (That was following the car discussion about why fabrics hold wrinkles and how ironing works.) It's quite disconcerting how electricity-dependent our lives are:: we started worrying about all the perishables in the refrigerator; original plans for pre-bed showering were dropped; and, of course, there was no way to use my computer. I'd nearly finished getting ready for bed (by candlelight) when my computer half scared me to death by starting up on its own. So, obviously, we have power again. Now I can go to bed without worrying about food spoiling.

Tuesday, September 02, 2003

Temporary fix (again). I'm logged on as Administrator and under strict instructions not to reboot my computer. I just need to make it to Friday, please...

Blarrrg. I came into work this morning to find my computer unable to connect to the network. The IT guy thinks that someone got mixed up on which week would be my last week, and thus disabled my port connection, but I think that's dumb because originally I was going to work until Sept. 12. I spoke with him several hours ago but no one has come by to fix it. So now I can't do my BLAST searches or print anything (or check my email, but that's less crucial). And I can only do so much from the lab computers because most of them are busy managing machines, and I can only transfer data using floppy disks (no CD burner). This is really not a good time to be inconvenienced by my computer. Sigh.

Monday, September 01, 2003

Aiya. This is one tired Tina typing after an immensely full day. It started very early, as usual, for church and Kids Community. Graham was visiting today, and I'm glad that he had so much fun with the kids in my class. (There were definitely a lot of funny moments, but I'm too exhausted to tell the stories right now. Maybe later.) Then, after lunch, we met up with Kari and Jeremy to work on choreography. That turned out to be very long -- four hours, to be exact. I was so tired afterward that I immediately zonked out as soon as I got back to my room. I slept right up until I had to be online for a Core meeting at 8:30 (dinner was eaten while typing away in the chatroom window). And I just now got done with that -- meaning that the Core meeting was also four hours long. It's practically like I put in a full day's work! Or even more than that, since it's been pretty much nonstop from before 8:00am. Everything is just coming down to the line with prepping for the groups I'm leading next year. Well, I guess I missed out on writing an "end of August" post, which I would do now if I wasn't so tired and if I hadn't already missed the August 31st timestamp. (With BloggerPro, I could change the time if I wanted, but that would be cheating.) Hopefully I'll be able to unwind tomorrow and spend some precious time with Chi-En (she and I unfortunately won't have very much overlapping time the rest of the week, even though she's staying here at the apartment; I'll be working during the day and she'll be busy with her brother's wedding preparations during the evenings). There's another choreography meeting tomorrow, but it should be much shorter since we're nearly done (yay!). I really need some quiet time, anyway -- especially before a super-busy final week at work. The three-day weekend is a mixed blessing. Anyway, it is definitely time for bed. (Or sofa, as the case may be. Chi-En has passed out on my bed, and I don't want to wake her up.)